Volume 11, Number 2—February 2005
Research
Spotted Fever Group and Typhus Group Rickettsioses in Humans, South Korea
Table 1
Oligonucleotide primers for amplification of partial rickettsial genes*
Primer | Target rickettsia group | Gene | Position | Nucleotide sequence (5′–3′) |
---|---|---|---|---|
rompB OF | SFG and TG | rompB† | 3,620–3,643 | GTAACCGGAAGTAATCGTTTCGTAA |
rompB OR | SFG and TG | rompB | 4,131–4,109 | GCTTTATAACCAGCTAAACCACC |
rompB SFG IF | SFG | rompB | 3,652–3,674 | GTTTAATACGTGCTGCTAACCAA |
rompB SFG/TG IR | SFG and TG | rompB | 4,077–4,057 | GGTTTGGCCCATATACCATAAG |
rompB TG IF | TG | rompB | 3,828–3,850 | AAGATCCTTCTGATGTTGCAACA |
RpCS.877p§ | SFG and TG | gltA‡ | 877–895 | GGGGGCCTGCTCACGGCGG |
RpCS.1,258n§ | SFG and TG | gltA | 1,258–1,237 | ATTGCAAAAAGTACAGTGAACA |
RpCS.896p | SFG and TG | gltA | 896–915 | GGCTAATGAAGCAGTGATAA |
RpCS.1,233n | SFG and TG | gltA | 1,233–1,215 | GCGACGGTATACCCATAGC |
*SFG, spotted fever group; TG, typhus group; OR, outer reverse primer; OF, outer forward primer.
†Oligonucleotide primer sequences derived from Rickettsia conorii genes (accession no. AF123721).
‡Oligonucleotide primer sequences derived from R. prowazekii genes (accession no. M17149).
§Primer sequences derived from (9).
References
- Choi MS, Park SK, Chang WJ, Huh MS, Kim HR, Han TH, A seroepidemiological survey on the scrub typhus in Korea, 1994. J Korean Soc Microbiol. 1994;30:593–602.
- Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev. 1997;10:694–719.PubMedGoogle Scholar
- Kim YW, Cho MK, Min CH, Yoon CS. Isolation and characterization of Rickettsia typhi from patients in Korea. J Korean Soc Microbiol. 1988;23:265–75.
- Song JW, Baek LJ, Lee YJ, Song KJ, Han SH. Seroepidemiologic analysis of acute rebrile illness from Korea in 1996. J Korean Soc Virol. 1998;28:377–82.
- Gross L. How Charles Nicolle of the Pasteur Institute discovered that epidemic typhus is transmitted by lice: reminiscence from my years at the Pasteur Institute in Paris. Proc Natl Acad Sci U S A. 1996;93:10539–40. DOIPubMedGoogle Scholar
- Chung HY. Suspected human infectious diseases in Korea; Rickettsial infections. Korean J Infect Dis. 1985;18:93–7.
- Lee JH, Park HS, Jung KD, Jang WJ, Koh SE, Kang SS, Identification of spotted fever group rickettsiae detected from Haemaphysalis longicornis in Korea. Microbiol Immunol. 2003;47:301–4.PubMedGoogle Scholar
- Jang WJ, Kim JH, Choi YJ, Jung KD, Kim YG, Lee SH, First serologic evidence of human spotted fever group rickettsiosis in Korea. J Clin Microbiol. 2004;42:2310–3. DOIPubMedGoogle Scholar
- Roux V, Rydkina E, Eremeeva M, Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol. 1997;47:252–61. DOIPubMedGoogle Scholar
- Chun J. Computer-assisted classification and identification of actinomycetes. [Ph.D. thesis]. Newcastle Tyne, United Kingdom: University of Newcastle upon Tyne; 1995.
- Zavala-Velazquez JE, Ruiz-Sosa JA, Sanchez-Elias RA, Becerra-Carmona G, Walker DH. Rickettsia felis rickettsiosis in Yucatan. Lancet. 2000;356:1079–80. DOIPubMedGoogle Scholar
- Richter J, Fournier PE, Petridou J, Haussinger D, Raoult D. Rickettsia felis infection acquired in Europe and documented by polymerase chain reaction. Emerg Infect Dis. 2002;8:207–8. DOIPubMedGoogle Scholar
- Parola P, Miller RS, McDaneiel P, Telford SR III, Rolain JM, Wongsrichanalai C, Emerging rickettsioses of the Thai-Myanmar border. Emerg Infect Dis. 2003;9:592–5.PubMedGoogle Scholar
- Rolain JM, Franc M, Davousr B, Raoult D. Molecular detection of pathogenic Bartonella and Rickettsia in cat fleas from France. Emerg Infect Dis. 2003;9:338–42.PubMedGoogle Scholar
- Hechemy KE, Raoult D, Fox J, Han Y, Elliotte LB, Rawlings J. Cross-reaction of immune sera from patients with rickettsial disease. J Med Microbiol. 1989;29:199–202. DOIPubMedGoogle Scholar
- Uchiyama T, Zhao L, Yan Y, Uchida T. Cross-reacttivity of Rickettsia japonica and Rickettsia typhi demonstrated by immunofluorescence and Western immunoblotting. Microbiol Immunol. 1995;39:951–7.PubMedGoogle Scholar
- Gurfield AN, Boulouis HJ, Chomel BB, Kasten RW, Heller R, Bouillin C, Epidemiology of Bartonella infection in domestic cats in France. Vet Microbiol. 2001;80:185–98. DOIPubMedGoogle Scholar
- Abbott RC, Chomel BB, Kasten RW, Floyd-Hawkins KA, Kikuchi Y, Koehler JE, Experimental and natural infection with Bartonella henselae in domestic cats. Comp Immunol Microbiol Infect Dis. 1997;20:41–51. DOIPubMedGoogle Scholar
Page created: April 27, 2011
Page updated: April 27, 2011
Page reviewed: April 27, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.