Volume 18, Number 4—April 2012
Letter
Rickettsia monacensis as Cause of Mediterranean Spotted Fever–like Illness, Italy
Table
Selected inner primers used to amplify rickettsial gltA and ompA genes*
Rickettsial groups | Gene | Primer | Nucleotide sequence, 5′ → 3′ | Product size, bp | Reference |
---|---|---|---|---|---|
Rickettsiae spotted fever group plus typhus group | gtlA | gltA–F | TCGCAAATGTTCACGGTACTTT | 74 | (8) |
gltA–R | TCGTGCATTTCTTTCCATTGTG | ||||
Rickettsiae ompA | ompA | ompA–F | ATGGCGAATATTTCTCCAAAA | 632 | (9) |
ompA–R | GTTCCGTTAATGGCAGCATCT |
*gltA, citrate synthase; ompA, outer membrane protein A.
References
- Ciceroni L, Pinto A, Ciarrocchi S, Ciervo A. Current knowledge of rickettsial diseases in Italy. Ann N Y Acad Sci. 2006;1078:143–9.DOIGoogle Scholar
- Márquez FJ, Muniain MA, Soriguer RC, Izquierdo G, Rodríguez-Bano J, Borobio MV. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am J Trop Med Hyg. 1998;58:570–7.
- Beninati T, Lo N, Noda H, Esposito F, Rizzoli A, Favia G, First detection of spotted fever group rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis. 2002;8:983–6.
- Simser JA, Palmer AT, Fingerle V, Wilske B, Kurtti TJ, Munderloh UG. Rickettsia monacensis sp. nov., a spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl Environ Microbiol. 2002;68:4559–66.DOIGoogle Scholar
- Sréter-Lancz Z, Sréter T, Széll Z, Egyed L. Molecular evidence of Rickettsia helvetica and R. monacensis infections in Ixodes ricinus from Hungary. Ann Trop Med Parasitol. 2005;99:325–30.DOIGoogle Scholar
- Chmielewski T, Podsiadly E, Karbowiak G, Tylewska-Wierzbanowska S. Rickettsia spp. in ticks, Poland. Emerg Infect Dis. 2009;15:486–8.DOIGoogle Scholar
- Jado I, Oteo JA, Aldámiz M, Gil H, Escudero R, Ibarra V, Rickettsia monacensis and human disease, Spain. Emerg Infect Dis. 2007;13:1405–7.
- Paris DH, Blacksell SD, Stenos J, Graves SR, Unsworth NB, Phetsouvanh R, Real-time multiplex PCR assay for detection and differentiation of rickettsiae and orientiae. Trans R Soc Trop Med Hyg. 2008;102:186–93.DOIGoogle Scholar
- Zhang L, Jin J, Fu X, Raoult D, Fournier PE. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. J Clin Microbiol. 2006;44:2465–7.DOIGoogle Scholar
- Di Todaro N, Piazza C, Otranto D, Giangaspero A. Ticks infesting domestic animals in Italy: current acarological studies carried out in Sardinia and Basilicata regions. Parassitologia. 1999;41(Suppl 1):39–40.
Page created: March 16, 2012
Page updated: March 16, 2012
Page reviewed: March 16, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.