To the Editor: Human granulocytic ehrlichiosis (HGE), a tick-associated febrile illness first described in Minnesota and Wisconsin in 1994 (1), has recently been reported in a number of European countries (2,3). Molecular and serologic characterization has shown that the HGE agent is closely related or identical to Ehrlichia equi and E. phagocytophila (4,5). In the United States, human cases of HGE overlap the range of the blacklegged tick, Ixodes scapularis, and the detection of HGE agent DNA in this species provides direct evidence that this arthropod is a competent vector (4). We report the first identification and characterization of an HGE-like agent in a blacklegged tick collected in a tick-endemic area of Canada (6).

Sixty male and 60 female I. scapularis were collected from five white-tailed deer shot on Long Point Peninsula, Ontario, during November 1999. Live ticks were cut longitudinally into halves, and half of each specimen was placed in lysis buffer from a QIAamp DNA Mini Kit (Qiagen Inc., Canada); DNA was extracted per manufacturer's instructions. Five microliters of extracted tick DNA was then added to a polymerase chain reaction (PCR) mixture containing primers Ehr 521 and Ehr 790 (7), and the resulting amplification products were run on agarose gels. Extracted DNA from one male tick generated the expected 293-bp HGE agent amplicon. Preliminary DNA sequencing analysis of the putative granulocytic Ehrlichia PCR product indicated a high sequence identity with HGE agent 16S rDNA. To further genotype this HGE-like agent, an 894-bp portion of 16S rDNA was amplified by using primers ge3a, ge9f, ge10r (8), and primer mdge9r (5' ATGTCAAGGAGTGGTAAGGT) in a nested PCR reaction.

Genetic characterization of the Long Point HGE-like agent (designated here as L3H) was carried out by sequencing an 849-bp portion of the rDNA gene and comparing it with other HGE-like agents in GenBank. Within the rDNA portion sequenced, L3H shares 99.6% identity with the HGE agent and E. equi/E. phagocytophila. In the 849-bp portion of the rDNA gene amplified and sequenced, the L3H strain differed from the HGE agent by three nucleotides. Comparison of L3H with HGE-like agents from the United States, Europe, and China suggests a high degree of sequence identity at the rDNA level; however, a number of nucleotide positions did show variation. (GenBank accession number for L3H is AF311343.)

This study documents for the first time (by rDNA sequence comparisons) that I. scapularis from a tick-endemic site in Canada can harbor an ehrlichia of the E. equi genogroup and is closely related to the HGE agent. The taxonomic significance of HGE-like agents that vary somewhat in their rDNA sequence is still unclear. HGE-like agents from diverse geographic locations and various hosts can exhibit nucleotide differences at a number of positions and still be >99% similar at the level of rDNA sequence identity. Recently it has been shown that sequencing of a more variable genomic region, such as the ank gene of granulocytic ehrlichia, can group these agents into different North American and European genetic clades or genogroups (9). Whether all HGE-like "variants" that differ somewhat in their rDNA or ank gene sequences can cause human or animal disease remains to be determined.

The identification of an HGE-like agent further highlights the concern that I. scapularis may transmit a number of pathogens to humans or other animals in Canada. Public health officials and veterinarians should be aware of this finding and consider HGE in the differential diagnosis of patients or clients with relevant clinical presentations. Further studies documenting the prevalence of the HGE-like agent(s) in ticks from Canada and characterization of any agents identified are warranted to better define potential human and animal health risks.

Top

Related Links

• More Letter Articles