Volume 8, Number 12—December 2002
Research
First Isolation of West Nile virus from a Patient with Encephalitis in the United States
Table 1
Primer | Genome target | Genome positionb | Sequence (5′–3′) | RT-PCR product size (bp) |
---|---|---|---|---|
CU9093 | NS5 | 9097–9120 | AGYMGRGCHATHTGGTWYATGTGG | 206 |
CL9279 | NS5 | 9302–9283 | TTCCAVCCDGCKGTRTCATC | |
D87F | NS5 | 10034–10051 | GCTCCGCTGTCCCTGTGA | 70 |
D156R | NS5 | 10103–10083 | CACTCTCCTCCTGCATGGATG | |
Forwardddd | ENV | 1160–1180 | TCAGCGATCTCTCCACCAAAG | 70 |
Reverse | ENV | 1229–1209 | GGGTCAGCACGTTTGTCATTG | |
Probe | ENV | 1186–1207 | TGCCCGACCATGGGAGAAGCTC |
aRT-PCR, reverse transcription–polymerase chain reaction.
bGenome position according to GenBank accession no. AF196835.
Page created: July 19, 2010
Page updated: July 19, 2010
Page reviewed: July 19, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.